Comparative evaluation of ‘TaqMan’ RT-PCR and RT-PCR ELISA for immunological monitoring of renal transplant recipients

Description
Comparative evaluation of ‘TaqMan’ RT-PCR and RT-PCR ELISA for immunological monitoring of renal transplant recipients

Please download to get full document.

View again

of 8
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Information
Category:

Magazines/Newspapers

Publish on:

Views: 0 | Pages: 8

Extension: PDF | Download: 0

Share
Tags
Transcript
  Transplant Immunology 11  ( 2003 )  65–720966-3274/03/$ - see front matter   2002 Elsevier Science B.V. All rights reserved.PII: S0966-3274 Ž 02 . 00086-2 Comparative evaluation of ‘TaqMan’ RT-PCR and RT-PCR ELISA forimmunological monitoring of renal transplant recipients Paul J. Gibbs *, Lam Chin Tan , Sami A. Sadek , W. Martin Howell a  ,  a a b Wessex and Renal Transplant Unit, St. Mary’s Hospital, Milton Road, Portsmouth, UK  a  Histocompatibility and Immunogenetics Laboratory, Southampton General Hospital, Tremona Road, Southampton, UK  b Received 11 March 2002; accepted 14 May 2002 Abstract By sequentially monitoring cytokine gene expression  ( using RT-PCR ELISA technology )  in peripheral blood cells of renaltransplant recipients in the early post-operatively period we have shown that expression patterns correlate with clinical events,namely acute allograft rejection. This strategy may have the potential of predicting acute rejection prior to clinical detection.Unfortunately, the technique used was time consuming and only semi-quantitative and, therefore, not suitable for clinicalapplication. In this study, we have sought to confirm the results of the early work using a real time quantitative RT-PCR technique ( ‘TaqMan’ ) , which may be applicable in the clinical laboratory. ‘TaqMan’ primers and probes were designed for Interleukin  ( IL ) -4 and IL-10 using Primer Express software. Cytokine gene expression for both cytokines was re-measured in stored cDNAsamples from 27 non-rejectors and 14 patients experiencing an episode of biopsy proven acute rejection. Compared to pre-transplant levels, IL-4 gene expression fell significantly on post-operative days 2 and 7 before returning to baseline values by day14 in the non-rejectors. In the rejectors, the initial significant fall was again seen, but with an earlier return to pre-transplantlevels at the time of rejection diagnosis. This was followed by a further significant fall in levels 48 h after the initiation of anti-rejection therapy. These different patterns for rejectors and non-rejectors were seen using both techniques. For IL-10, geneexpression increased significantly following transplantation throughout the study period when compared to baseline values. Thispattern was seen using both techniques. In the rejectors, there were different patterns seen depending on the technique used.When using RT-PCR ELISA, the initial rise was again seen followed by a return to baseline values at the time of rejectiondiagnosis followed by a further significant rise in gene expression after the start of anti-rejection treatment. The pattern resembledthose of the non-rejectors when expression was measured using ‘TaqMan’. This study has confirmed that sequential monitoringof cytokine gene expression, measured in peripheral blood mononuclear cells, detects significant changes that correlate withclinical events in renal transplant recipients, including acute rejection, although not all changes detected with RT-PCR ELISAwere confirmed. Therefore, real time quantitative RT-PCR technology may be useful in monitoring the immunological status of these patients in the early post-operative period.   2002 Elsevier Science B.V. All rights reserved. Keywords:  Immunological monitoring; Cytokines; Renal transplantation; Acute allograft rejection; RT-PCR ELISA; ‘TaqMan’ 1. Introduction Acute allograft rejection following renal transplanta-tion is still a common problem, affecting approximately30% of transplanted kidneys  w 1–6 x . Acute allograftrejection is a T cell mediated response. It results in the *Corresponding author. Present address: 3, Coronation Cottages,Routs Way, Southampton, SO16 8JG, UK; Tel.: q 44-23-80733696.  E-mail address:  paulgibbs@torre.demon.co.uk   ( P.J. Gibbs ) . specific recognition and destruction of an alloantigen-expressing donor organ. Secretion of cytokines by donor-specific, activated T cells is important in augmentinginflammation w 7 x .Cytokines are potent, pleiotrophic, non-antigen-bind-ing polypeptides secreted by cells of the immune system.They are produced in response to a variety of stimuliincluding regulation of the immune response to foreignantigens and invading organisms. They are involved in  66  P.J. Gibbs et al. / Transplant Immunology 11 (2003) 65–72 cell recruitment, activation, differentiation and prolifer-ation. They act on their target cell via specific surfacereceptors primarily through autocrine and paracrine stim-ulation w 8–10 x . Therefore, analysis of cytokine produc-tion during acute rejection episodes may enhance ourunderstanding of the rejection process. Not surprisingly,many studies have been performed to investigate therole of cytokines in the acute rejection process. Someof these have tried to explain the interactions and rolesthat various cytokines play in the process  w 11–20 x .Others have studied cytokines to examine their possibleusage as early predictors of the immune status of anorgan recipient w 21–29 x .There is a considerable lack of agreement in theliterature concerning the measurement of cytokines bothat the time of rejection and preceding the diagnosis.This is true for both intragraft studies and serum studiesin renal transplant recipients. In an attempt to clarifysome of these issues, our group has published work thatinvolved monitoring sequential changes in both Th1 andTh2 cytokine mRNA expression in T lymphocytesobtained from peripheral blood in a series of 43 renaltransplant recipients w 29 x . Blood samples were obtainedfrom all patients pre-transplant and then regularly withinthe first 4 weeks thereafter. A RT-PCR technique wascombined with an ELISA method of detecting digoxi-genin-labelled PCR products. This was used to semi-quantitatively detect sequential changes in expression of six cytokines  ( Interleukin  ( IL ) -2, Interferon- g , IL-4, IL-5, IL-10 and IL-13 ) . Two of the cytokines studiedshowed distinct patterns that correlated with clinicalevents and were different in the patients experiencingan episode of biopsy proven acute rejection comparedwith a recipient that did not reject. These cytokines wereIL-4 and IL-10.IL-4 expression was significantly reduced in non-rejectors for the first week following transplantation, buthad reverted to baseline levels by the week 2 sample.However, in rejectors the return to baseline was seenearlier, at the time of rejection. Levels fell again follow-ing treatment, but were at baseline levels at a week post-treatment.IL-10 was the only cytokine to have significantlyelevated levels of expression following transplantation.This was maintained at all time points in the non-rejector group, but at the time of rejection there was arelative fall in expression with levels comparable tobaseline. Following treatment, expression levels signifi-cantly rose again, but this increase was only seen in theearly post-treatment phase. Thereafter, levels were notsignificantly different from baseline expression.These results demonstrated the potential use of periph-eral blood cell cytokine gene expression measurementas a clinical tool in monitoring renal transplant recipi-ents. However, the RT-PCR ELISA technique has anumber of shortcomings. It is time consuming, requiresextensive post-PCR manipulation, measures end-pointPCR product accumulation and is, at best, semi-quanti-tative. Quantitative real time PCR technology overcomesthese problems. This paper describes the methodologyused and results obtained from our early experience of measuring cytokine gene expression in renal transplantrecipients using this technique. 2. Objective The previous study had identified that cytokine geneexpression in peripheral blood cells, measured with aRT-PCR ELISA technique, correlated with clinicalevents in renal transplant recipients in the early post-operative period. The objective of this study was to usea fully quantitative RT-PCR technique  ( ‘TaqMan’ )  toconfirm the results of this earlier work and to developtechniques applicable to comprehensive immunologicalmonitoring in the clinical setting. 3. Materials and methods 3.1. RT-PCR ELISA study This study was performed using cDNA samplesobtained previously. Patient demographics and method-ology has been published in full w 29 x , but is summarisedbelow.Blood samples were obtained from a series of 43renal transplant recipients  ( transplanted at our centreduring 1996 and 1997 )  pre-operatively and then regu-larly within the first 4 weeks thereafter. If a patientexperienced an episode of biopsy proven acute allograftrejection  ( 15 of the 43 recipients ) , additional bloodsamples were obtained prior to the initiation of anti-rejection therapy and after completion of the treatment,up to 4 weeks post-transplant  ( sampling schedule isshown in Table 1 ) .Mononuclear cells were extracted by density gradientcentrifugation, the T cells were negatively selected usingmonoclonal antibodies and the RNA extracted usingRNAzolB  ( Biogenesis, UK ) . The extracted RNA wasquantitated and standardised prior to reverse transcrip-tion to cDNA. An RT-PCR technique was combinedwith an ELISA method of detecting digoxigenin-labelledPCR products  ( Boehringer Mannheim, UK ) . This wasused to semi-quantitatively detect sequential changes inexpression of the cytokines. cDNA that was not used inthe srcinal study was labelled and stored at  y 70  8 Cfor future analysis. There was sufficient material to re-analyse 27 y 28 non-rejectors and 14 y 15 of the rejectorsusing ‘TaqMan’ technology.As the RT-PCR ELISA is a semi-quantitative tech-nique, the statistical analysis compared the percentagechange in the ELISA plate readings rather than theabsolute values. The analysis was performed using the  67 P.J. Gibbs et al. / Transplant Immunology 11 (2003) 65–72 Table 1Sampling schedules for both rejecting and non-rejecting recipientsTime point Non-rejectors Time point Rejectors1 Pre-transplant 6 Pre-transplant2 Day 2 post-transplant 7 Day 2 post-transplant3 1 Week post-transplant 8 Pre-therapy4 2 Weeks post-transplant 9 Day 2 post-therapy5 4 Weeks post-transplant 10 1 Week post-therapy11 2 Weeks post-therapyThis table shows the sampling schedule for both the rejectors and non-rectors. Therapy refers to anti-rejection treatment.Table 2‘TaqMan’ primer and probe sequencesCytokine Primer y probe SequenceIL-4 Sense primer GTGCACCGAGTTGACCGTAAIL-4 Anti-sense primer TGTAGAACTGCCGGAGCACAIL-4 Fam-labelled probe CTTTGCTGCCTCCAAGAACACAACTGAGAIL-10 Sense primer AGGCGCATGTGAACTCCCTIL-10 Anti-sense primer CACGGCCTTGCTCTTGTTTTIL-10 Fam-labelled probe AGGCTACGGCGCTGTCATCGATTTCTThis table shows the cytokine primer and probe sequences for both IL-4 and IL-10. The exon y exon boundaries are underlined for each probe. Wilcoxon Signed Ranks test. However, the results beloware shown as absolute values for comparison with the‘TaqMan’ data. 3.2. ‘TaqMan’ study As part of the project, primers and probes weredesigned using PE Primer Express Software  ( AppliedBiosystems, UK ) . This program allows the user todesign ‘TaqMan’ primers and probes for optimal PCRamplification and probe incorporation under a standardset of PCR conditions. The sequences of the primersand probes that were used are shown in Table 2. Foreach of the probes the two bases either side of theexon y exon boundaries are underlined  ( probes must over-lap such boundaries ) . Primers were synthesised byOswell DNA Services, UK, while Applied Biosystems,UK, manufactured the probes.The conditions for every PCR reaction are universal ( stage 1 is a 2-min hold at 50  8 C, stage 2 is a 10 minhold at 95  8 C and stage 3 is 40 cycles consisting of 15s at 95  8 C followed by 60 s at 60  8 C ) . This allowedboth IL-4 and IL-10 gene expression to be analysedsimultaneously, for each patient, on the same 96-wellplate. To reduce the error of a failed or sub-optimalPCR reaction, each sample was run in duplicate. Theseries was repeated, for that gene, if there was adiscrepancy of more than one cycle between the twosamples. The mean of the two was used for subsequentstatistical analysis.For each sample analysed, 49  m l of master-mix  ( 25 m l ‘TaqMan’ Universal PCR Master Mix  ( 2 = ) , 21  m lRNAse free water, 1  m l 5 9  Primer, 1  m l 3 9  Primer, 1  m lProbe )  was added to 1  m l of cDNA.  ( The workingconcentration for the primers was 300  h M and the probewas 100  h M ) . Then 25- m l aliquots of each reaction mixwere carefully transferred to adjacent wells of aMicroAmp Optical 96-Well Reaction Plate  ( AppliedBiosystems, UK )  covered with Optical Caps  ( AppliedBiosystems, UK ) . The plate was then transferred to theABI Prism 7700 Sequence Detector  ( Applied Biosys-tems, UK )  and the run commenced.When the run was completed, output data wereexported into a Microsoft Excel file  ( Microsoft Corpo-ration, USA )  for later analysis. Statistical analysis wasperformed using the Wilcoxon Signed Ranks test, whichhad been the method of analysis in the early study.Statistical significance was taken at  P - 0.05  ( SPSS,Version 10, USA ) . 4. Results The results of the findings for both IL-4 and IL-10for both techniques, and for rejectors and non-rejectors,are shown as box and whisker plots  ( Figs. 1–4 ) . In thecase of the RT-PCR ELISA study, the  Y  -axis gives thevalues from the spectrophotometer used to measure thecolour change in each well. This value is related to theamount of starting material measured. In the case of the‘TaqMan’ study, the  Y  -axis gives the values at whichthe PCR reaction enters the exponential growth phase ( C   value ) , which is inversely related to the amount of  T starting material measured. The  X  -axis represents thevarious time points on which the samples were collected ( see Table 1 ) . In several of the grafts the more extremevalues have been plotted individually, but were included  68  P.J. Gibbs et al. / Transplant Immunology 11 (2003) 65–72 Fig. 1.  ( a )  IL-4 box and whisker plot for the non-rejectors using RT-PCR ELISA. This box and whisker plot shows the IL-4 gene expres-sion data for the non-rejectors using the original RT-PCR ELISAsystem. The  Y  -axis gives the values from the spectrophotometer read-ings, which are proportional to the amount of starting material. Thesampling points are on the  X  -axis.  ( b )  IL-4 box and whisker plot forthe non-rejectors using ‘TaqMan’. This box and whisker plot showsthe IL-4 gene expression data for the non-rejectors using the ‘TaqMan’system. The  Y  -axis gives the  C   values, which are inversely propor- T tional to the amount of starting material. The sampling points are onthe  X  -axis.Fig. 2.  ( a )  IL-10 box and whisker plot for the non-rejectors using RT-PCR ELISA. This box and whisker plot shows the IL-10 gene expres-sion data for the non-rejectors using the original RT-PCR ELISAsystem. The  Y  -axis gives the values from the spectrophotometer read-ings, which are proportional to the amount of starting material. Thesampling points are on the  X  -axis.  ( b )  IL-10 box and whisker plot forthe non-rejectors using ‘TaqMan’. This box and whisker plot showsthe IL-10 gene expression data for the non-rejectors using the‘TaqMan’ system. The  Y  -axis gives the  C   values, which are inversely T proportional to the amount of starting material. The sampling pointsare on the  X  -axis. in the statistical analysis. The results are also shown intabular form  ( Tables 3 and 4 ) .IL-4 gene expression was significantly lower thanpre-transplant levels on day 2 and at 1 week followingsurgery in the non-rejecting recipients for both RT-PCRELISA and ‘TaqMan’ analysis. In the rejecting recipientsthe results were again very similar for the two tech-niques, showing an initial significant fall in levels but areturn to pre-transplant levels at the time of rejection.The commencement of anti-rejection therapy was fol-lowed by a further significant fall in levels seen withboth methods.IL-10 gene expression was significantly elevated,compared with pre-transplant levels, throughout thestudy period in the non-rejectors using both methods of gene detection. In the rejectors, there was an initialsignificant rise in gene expression detected that returnedto baseline levels at the time of rejection diagnosis inthe ELISA study with a further significant increase inexpression following treatment with anti-rejection ther-apy. However, this fluctuation in expression prior to thecommencement of additional immunosuppression wasnot seen when using ‘TaqMan’. In that instant thesignificant increase seen immediately post-transplantwas maintained. 5. Discussion Sequential monitoring of peripheral T cell cytokinegene expression using a sensitive RT-PCR ELISA detec-  69 P.J. Gibbs et al. / Transplant Immunology 11 (2003) 65–72 Fig. 3.  ( a )  IL-4 box and whisker plot for the rejectors using RT-PCRELISA. This box and whisker plot shows the IL-4 gene expressiondata for the rejectors using the srcinal RT-PCR ELISA system. The Y  -axis gives the values from the spectrophotometer readings, whichare proportional to the amount of starting material. The samplingpoints are on the  X  -axis.  ( b )  IL-4 box and whisker plot for the rejec-tors using ‘TaqMan’. This box and whisker plot shows the IL-4 geneexpression data for the rejectors using the ‘TaqMan’ system. The  Y  -axis gives the  C   values, which are inversely proportional to the T amount of starting material. The sampling points are on the  X  -axis.Fig. 4.  ( a )  IL-10 box and whisker plot for the rejectors using RT-PCRELISA. This box and whisker plot shows the IL-10 gene expressiondata for the rejectors using the srcinal RT-PCR ELISA system. The Y  -axis gives the values from the spectrophotometer readings, whichare proportional to the amount of starting material. The samplingpoints are on the  X  -axis.  ( b )  IL-10 box and whisker plot for therejectors using ‘TaqMan’. This box and whisker plot shows the IL-10 gene expression data for the rejectors using the ‘TaqMan’ system.The  Y  -axis gives the  C   values, which are inversely proportional to T the amount of starting material. The sampling points are on the  X  -axis.Table 3RT-PCR ELISA and ‘TaqMan’ results for non-rejecting recipientsCytokines Post-transplant time pointsDay 2 1 Week 2 Weeks 4 WeeksIL-4 by RT-  x  Expression  x  Expression NS NSPCR ELISA  P s 0.001  P s 0.006IL-4 by  x  Expression  x  Expression NS NS‘TaqMan’  P - 0.001  P - 0.001IL-10 by RT-  ≠  Expression  ≠  Expression  ≠  Expression  ≠  ExpressionPCR ELISA  P s 0.002  P s 0.008  P s 0.041  P s 0.001IL-10 by  ≠  Expression  ≠  Expression  ≠  Expression  ≠  Expression‘TaqMan’  P - 0.001  P - 0.001  P s 0.045  P s 0.008This table shows the same results as the box and whiskers plots of the non-rejectors for both techniques and both cytokines. Arrows indicatethe direction of the change in expression from the baseline value. The numbers given are the  P  values. NS s non-significant.
Related Search
Similar documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks