Construction of Transgenic Drosophila by Using the Site-Specific Integrase From Phage φc31 - PDF

Copyright 2004 by the Genetics Society of America Construction of Transgenic Drosophila by Using the Site-Specific Integrase From Phage φc31 Amy C. Groth,* Matthew Fish, Roel Nusse and Michele P. Calos*,1

Please download to get full document.

View again

of 8
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.

Spiritual/ Inspirational

Publish on:

Views: 48 | Pages: 8

Extension: PDF | Download: 0

Copyright 2004 by the Genetics Society of America Construction of Transgenic Drosophila by Using the Site-Specific Integrase From Phage φc31 Amy C. Groth,* Matthew Fish, Roel Nusse and Michele P. Calos*,1 *Department of Genetics and Department of Developmental Biology, Stanford University School of Medicine, Stanford, California Manuscript received July 21, 2003 Accepted for publication December 19, 2003 ABSTRACT The φc31 integrase functions efficiently in vitro and in Escherichia coli, yeast, and mammalian cells, mediating unidirectional site-specific recombination between its attb and attp recognition sites. Here we show that this site-specific integration system also functions efficiently in Drosophila melanogaster in cultured cells and in embryos. Intramolecular recombination in S2 cells on transfected plasmid DNA carrying the attb and attp recognition sites occurred at a frequency of 47%. In addition, several endogenous pseudo attp sites were identified in the fly genome that were recognized by the integrase and used as substrates for integration in S2 cells. Two lines of Drosophila were created by integrating an attp site into the genome with a P element. φc31 integrase injected into embryos as mrna functioned to promote integration of an attb-containing plasmid into the attp site, resulting in up to 55% of fertile adults producing transgenic offspring. A total of 100% of these progeny carried a precise integration event at the genomic attp site. These experiments demonstrate the potential for precise genetic engineering of the Drosophila genome with the φc31 integrase system and will likely benefit research in Drosophila and other insects. pared, and for each set of two transgenes analyzed, a new P-element insertion must be made, which will be at a different location. Another approach to the site-specific integration prob- lem is the use of homologous recombination. The fre- quency of homologous recombination has been too low to be of practical use in Drosophila. However, the fre- quency of homologous recombination can be boosted by using P-element transformation to insert a construct containing the gene to be targeted, engineered with an I-SceI cutting site and flanked by two FRT sites. This construct can then be mobilized as a circular DNA mole- cule by expression of FLP and made linear by the expression of I-SceI, increasing the targeted recombination frequency (Rong and Golic 2000, 2001; Rong et al. 2002). In this system, a separate P-element insertion carrying the homologous DNA engineered with I-SceI and FLP sites is required for each gene to be targeted. By this method, a targeted event could be obtained at a frequency of 1 in ,000 gametes from the female germline. Ideally, one could target an insertion to any position in the genome. However, even this increased frequency of homologous recombination is not high enough to allow researchers to target many different genes in an efficient way. In lieu of the ability to insert genes into any desired place in the genome, a system that allows a researcher to insert any gene efficiently into one specified place would be useful. Such experiments have been conducted with the FLP/FRT system in Drosophila. An integration frequency of up to 5% into a FRT site in the Drosophila genome can be obtained when the target DNA is mobi- DROSOPHILA melanogaster is an excellent model organism for genetic studies due to its short generation time, ease of screening, polytene chromosomes, and sequenced genome. A very useful tool for the study of gene function in Drosophila is the P-element transposition system (Rubin and Spradling 1982). P elements have been utilized to knock out genes as well as to insert genes into the Drosophila genome. However, the insertion of genes occurs randomly. An efficient sitespecific integration method would address one drawback of fly research. While random P-element integration is useful for studies of gene function (O Kane and Gehring 1987; Spradling et al. 1999), position effects can strongly influence gene expression, complicating the phenotypic analysis (Levis et al. 1985). It is therefore desirable to be able to insert genes at the same chromosomal location. A system involving Cre and FLP that allows researchers to study the function of two genes at identical places in the genome has been developed (Siegal and Hartl 1996, 2000). In that system, a fly line is created by P-element insertion that contains the two transgenes of interest flanked by either loxp or FRT sequences. Under Cre expression, one transgene is re- moved, while under FLP expression, the other trans- gene is removed. Each remaining transgene is then left in the same chromosomal context. Disadvantages of this approach are that only two genes can be directly com- 1 Corresponding author: Department of Genetics, Stanford University School of Medicine, 300 Pasteur Dr., Stanford, CA Genetics 166: (April 2004) 1776 A. C. Groth et al. bottom (GAT CCG GTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TGG CGC) were annealed, digested with BamHI, and inserted into the BamHI site in pet11φc31 to create pet11φc31poly(a). The plasmid pcaryp (Figure 1E) was created by removing attp from ptaattp (Groth et al. 2000) by EcoRI digestion, filling in with T4 DNA polymerase (New England Biolabs, Beverly, MA), and cloning it into the SmaI site of pcary, a plasmid containing the yellow body color gene (gift of the Bruce Baker lab). The plasmid puastb (Figure 1F) containing the white gene and φc31 attb was created as follows. The attb was re- moved from ptaattb, blunted with T4 DNA polymerase, and cloned into the BamHI sites of puast (Brand and Perrimon 1993). Transient intramolecular recombination assay: The plasmid pbcpb (Figure 1B), containing a lacz gene flanked by wild- type attb and attp sites, was used to assay recombination (Groth et al. 2000). D. melanogaster S2 cells were maintained at 25 in Schneider medium supplemented with 9% fetal bovine serum, 1% penicillin/streptomycin. Cells were transfected with Fu- GENE 6 (Roche Diagnostics, Indianapolis) as follows. The DNA (salmon sperm carrier, pbcpb and carrier, or pbcpb and pmkint) was added to an Eppendorf tube. Amounts of DNA were as follows: 50 ng pbcpb,2 g pmkint, and carrier to a total of 2.05 g. A total of 100 l Opti-Mem was added to each tube, followed by 12.3 l FuGENE 6. After a 15- to 30-min incubation, the mixture was added to a 60-mm dish of S2 cells at 80% confluency. At 24 hr, 50 units/ml DNaseI was added to destroy untransfected DNA, and 1/100 culture volume of CuSO 4 was added to induce integrase expression. At 72 hr, the DNA was harvested for Hirt extractions (Hirt 1967; Smith and Calos 1995). Extracted DNA was then transformed into electrocompetent DH10B Escherichia coli, spread on agar plates containing 25 g/ml chloramphenicol and 50 g/ml 5-bromo-4-chloro-3-indolyl -d-galactoside (Xgal), and white and blue colonies were counted. The percentage of recombination was calculated as (number of white colonies)/ (total number of colonies) 100. Pseudo att site identification: The plasmid pdrbb2 (Figure 1C) was cotransfected with pmkint-hyg (Figure 1D) into S2 cells. Cells were transfected with 20 g of the integrase plasmid and/or 400 ng of the donor plasmid. All transfections were made up to 20.4 g with salmon sperm carrier DNA. The integrase was induced at 24 hr by the addition of CuSO 4. Cells were selected with 125 g/ml hygromycin for 5 6 weeks, at which time the cells were harvested and the genomic DNA was recovered with the QIAGEN (Valencia, CA) blood and cell culture Maxi kit. Genomic DNA was digested with two enzymes, for example, EcoRI and HindIII, which cut pdrbb2 on either side of attb. The DNA was then ligated at low concen- tration and subjected to nested PCR across the junction. The external primers were attlf1 (ATGCCGATATACTATGCC GATG) and attlr1 (GGTCCGGGACGACGTGA). The internal primers were attlf2 (GGATCAATTCGGCTTCAGG) and attlr2 (GCTGTACGCCGAGTGGT). The resulting PCR bands were gel isolated using the QIAGEN QiaQuick kit and Topo cloned using the Topo cloning kit (Invitrogen, Carlsbad, CA). DNA was prepared from resulting colonies with the QIAGEN Miniprep spin kit and sequenced using the T7 or M13 reverse primers. Sequences were examined with the Fly BLAST program ( to identify Drosophila genomic sequence. Transient excision assay in whole flies: The φc31 mrna was produced as follows. The plasmid pet11φc31poly(a) was digested with BamHI to linearize it directly after the poly(a) of the integrase gene. A total of 1 g of digested DNA was lized from elsewhere in the genome by FLP excision (Golic et al. 1997). However, this system still requires the creation of a new P-element line for each transgene. The site-specific integrase from phage φc31 (Thorpe and Smith 1998) has been shown to function at high frequency in human and mouse tissue culture cells and in vivo in mice (Groth et al. 2000; Thyagarajan et al. 2001; Olivares et al. 2002; Ortiz-Urda et al. 2002, 2003a,b). The φc31 integrase requires no cofactors and mediates recombination between two sequences, the attb and attp sites, to create stable recombinants (Thorpe and Smith 1998). Both intra- and intermolecular recombination occur at high frequencies, and essentially no reversion of the reaction occurs. It has been demonstrated that the integrase can recognize and integrate into endogenous pseudo attp sites in the human and mouse genomes that have partial identity to attp (Thyagarajan et al. 2001; Olivares et al. 2002). Mouse and human pseudo attp sites are typically 30 45% identical to the wild-type attp. It seemed likely that the φc31 integrase system would also function in Drosophila and could benefit research in this organism by providing an efficient, site-specific integration tool. Experiments conducted in this study demonstrate that the φc31 in- tegrase can mediate intra- and intermolecular site-spe- cific recombination at high frequency in Drosophila S2 cells and that pseudo attp sites exist in the fly genome. In addition, transgenic flies were created in attp-containing fly lines at an average frequency of 47% of fertile crosses, by integrating an attb-containing plasmid injected along with integrase mrna into Drosophila em- bryos. MATERIALS AND METHODS Plasmids: A plasmid, pmkint (Figure 1A), which expresses φc31 integrase under the inducible control of the metallothio- nein promoter, was constructed as follows. The φc31 integrase gene was removed from the plasmid pcmvint (Groth et al. 2000) by digestion with BamHI and SpeI. This fragment was blunted with T4 DNA polymerase and ligated into the unique EcoRV site of the plasmid pmk33 (Bhanot et al. 1996). The donor plasmid pdrbb2 (Figure 1C) was created as follows. The hygromycin gene driven by the copia promoter was removed from pmk33 by SspI digestion. The hygromycin gene was removed from pbb1 (Thyagarajan et al. 2000) by PvuII and PflMI digestion and replaced with the copiahygromycin cassette. To create the plasmid pmkint-hyg (Fig- ure 1D), the hygromycin gene was removed from the plasmid pmkint by BglII and SnaBI digestion. The φc31 integrase gene was amplified to include the NdeI restriction site from the pta-int plasmid (Groth et al. 2000), using the primers Native 5 NdeI ( ) (CGA CTA GTC ATA TGG ACA CGT ACG CGG GTG CT) and 3 BamHI φc31 (AGC CGG ATC CGG GTG TCT CGC TA). The pet11 vector (Novagen, Madison, WI) was modified to contain the previously amplified φc31 integrase gene directionally inserted into NdeI and BamHI sites so that the T7 promoter drives φc31 integrase RNA production (pet11φc31). The oligonucleo- tides BamHI-poly(A)-top (GAT CGC GCC AAA AAA AAA AAA AAA AAA AAA AAA AAA AAA CCG) and BamHI-poly(A)- φc31 Integrase in Drosophila 1777 Figure 1. Schematic of six plasmids used in demonstrating the utility of the φc31 integrase in Drosophila. (A) pmkint, a plasmid expressing integrase under the control of the metallothionein promoter. (B) pbcpb, a plasmid containing lacz flanked by attb and attp. (C) pdrbb2, a plasmid containing attb and the hygromycin resistance gene driven by the copia promoter. (D) pmkint-hyg, a plasmid derived from pmkint that does not express the hygromycin resistance gene. (E) pcaryp, a plasmid containing attp and the yellow gene within a P-element cassette. (F) puastb, a plasmid containing attb and the mini-white gene. used as template for the RNA production protocol of the by a standard protocol and hybridized overnight to an attp mmessage mmachine kit (Ambion, Austin, TX). A total of probe. The probe was prepared by removing the attp site from 600 ng/ l of either pmkint (Figure 1A) or φc31 RNA was pta-attp by EcoRI digestion and radiolabeling using Readyco-injected into fly embryos with 200 ng/ l of pbcpb (Figure To-Go DNA labeling beads (Amersham Biosciences, Piscata- 1B). At 48 hr, embryos were harvested, crushed, and incu- way, NJ). bated with Proteinase K (Invitrogen) at 65. Resulting DNA was subjected to PCR (AttB F 2, ATGTAGGTCACGGTCTCGAAGC; AttP1, TGGCGGCCGCTCTAGAACTA), transformed into RESULTS bacteria, and screened as above. AttP fly lines: A total of 600 ng/ l of pcaryp (Figure 1E) Intramolecular recombination in S2 cells: To test was co-injected with 125 ng/ l of transposase-expressing plas- whether the φc31 integrase functions in Drosophila mid into w,y embryos according to a standard protocol. cells, a plasmid that expressed the integrase gene under Flies that grew to adulthood were crossed to w,y flies. the control of the metallothionein promoter was con- Eight y fly lines were isolated, of which two could be made homozygous. The insertions were localized by GenomeWalker structed. This plasmid was cotransfected with the assay (BD Biosciences, Palo Alto, CA) to chromosomes 2R (attp1) plasmid pbcpb (Figure 1B) into Drosophila S2 cells. and 3L (attp2). Primers were designed to determine if a fly Integrase was induced with CuSO 4 at 24 hr, and the line was transgenic attp1 or attp2. AttP1 was identified using cells were harvested at 72 hr. The low molecular weight DrGSP2 (CGAAATTTATGAGTGACTCTGCGACGTA) and DNA was harvested by Hirt extraction and transformed A1-2R for (GCCGCTCAGAGACCGTTTGTGTATGTGC). AttP2 was identified using PCP for (GTCGCCGACATGACACAAG) into bacteria to assay for recombination. The plasmid and A2-3L rev (CTCTTTGCAAGGCATTACATCTG). pbcpb contained the lacz gene flanked by the φc31 Integration into attp fly lines: A total of pl of between attb and attp attachment sites. If a recombination event 800 and 1000 ng/ l φc31 RNA was co-injected into attp fly occurred in the Drosophila cells, the resulting plasmid embryos with ng/ l puastb DNA. Flies that grew produced a white bacterial colony on plates containing to adulthood were crossed with w,y flies. Fly DNA from red-eyed offspring was prepared according to the DNEasy Xgal. If no recombination event occurred, lacz was ex- protocol (QIAGEN). Integration was analyzed by PCR, by using pressed and the plasmid resulted in a blue colony. The primers specific for the puastb (GCTCCGCTGTCA percentage of recombinants was then calculated by CCCTG) and pcaryp (GGCTTCACGTTTTCCCAGGT; Figure counting the white colonies, dividing by the total num- 1E) plasmids, or by Southern blot. ber of colonies, and multiplying by 100. Southern blots were performed as follows. A total of g of genomic DNA was digested overnight with XmnI, subment included carrier-only, integrase-only, and pbcpb - The experiment was repeated in triplicate. Each experijected to gel electrophoresis, and transferred to a Nytran membrane (Schleicher & Schuell, Keene, NH). Blots were prepared only transfections, and three plates transfected with integ- 1778 A. C. Groth et al. TABLE 1 Drosophila pseudo attp sites: Once it was established Transient intramolecular recombination in S2 cells that the φc31 integrase functioned well in Drosophila, DNA transfected (no. White Total % experiments were conducted to determine whether the Drosophila genome contained endogenous sequences independent transfections) colonies colonies recombination that could support φc31-mediated integration. S2 cells were cotransfected with pdrbb2 (Figure 1C) and pmkint- Carrier only (3) 0 0 NA pmkint only (3) 0 0 NA hyg (Figure 1D), induced for integrase expression, and pbcpb only (3) selected for 6 weeks. Genomic DNA was then recov- pmkint and pbcpb (9) ered and analyzed for integration events. To recover NA, not applicable. only integration events and not unintegrated plasmid, a PCR rescue technique was utilized. The genomic DNA was digested with two enzymes, for example, HindIII rase and assay plasmid. The amounts of DNA and the and EcoRI, that cut on either side of the attb in pdrbb2. transfection method used make it unlikely that cells The digested DNA was ligated overnight under dilute would receive pbcpb and not the integrase plasmid. conditions (20 ng/ l). The small pieces of DNA that Recombination occurred at a frequency of 47%, while resulted from unintegrated plasmid should not be able only 2% of the pbcpb -only controls were white (Table to ligate to themselves, due to incompatible ends. How- 1). Forty-seven percent was likely an underestimate, due ever, if an integration event occurred, the plasmid may to untransfected donor plasmid that was never in confound have integrated near an EcoRI site. If an EcoRI site was tact with integrase protein. DNA from 53 of 56 white in the genome before a HindIII site, then the colonies from the integrase and pbcpb cotransfeccle. EcoRI sites could ligate to each other, forming a minicir- tions analyzed by PCR had the expected product (95%). The ligations were subjected to nested PCR across Four of these were sequenced and had the perfect crossisolated, the ligation junction. Bands of different sizes were gel over event. The 2% white colonies from the donor-only Topo cloned, sequenced, and subjected to transfection were likely caused by transfection-related BLAST analysis. Sequences that were identified as Dro- mutation (Lebkowski et al. 1984), as has been seen sophila sequences were subjected to further analysis. before (Groth et al. 2000; Olivares et al. 2001; Stoll Oligos were designed to the Drosophila genome flanket al. 2002). DNA from all white colonies that resulted ing the crossover region. The hybrid attl and attr junc- from a control transfection was analyzed by PCR for the tions were then amplified by PCR from the selected recombination junction, and none had the expected genomic DNA, Topo cloned, and sequenced. Perfect band. To ensure that the recombination occurred in crossovers were found at several genomic sequences. the Drosophila cells and not in the bacteria, the integare Three pseudo attp sites from the Drosophila genome rase and assay plasmids were cotransformed directly into listed in Table 2. These pseudo sites were 23 41% bacteria. No white colonies were found out of 1698 identical to the minimal 39-bp wild-type attp, similar to total colonies, indicating that pmkint did not express the level of identity in mammalian pseudo attp sites integrase in bacteria and that the recombination ocvares that have been isolated (Thyagarajan et al. 2001; Olicurred in the S2 cells. These experiments demonstrated et al. 2002). Dps1 was located on the X chromo- that the φc31 integrase functioned efficiently in the some in an intron of the Tre1 gene. Dps2 was located Drosophila cell environment. in the repeated copia element, while Dps3 was located Integration in vivo: To verify that the φc31 integrase on chromosome 2L, upstream of the mdg1 transposon. functioned in vivo in flies, a simple excision assay was An experiment was conducted to try to achieve inte- performed. Embryos were co-injected with pbcpb gration at pseudo attp sites in vivo. A total of 700 ng/ (Figure 1B) plasmid DNA and either φc31 integrase l ofφc31 mrna and 150 ng/ l puastb (Figure 1F) mrna or
Related Search
Similar documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks