Biologically active salivary proteins, functional studies of the. alpha-amylase and the epidermal growth factor. Dr. Ákos Nagy - PDF

Description
Theses Biologically active salivary proteins, functional studies of the alpha-amylase and the epidermal growth factor Dr. Ákos Nagy Dental Research, Clinical Medicine Semmelweis University, School of Ph.D.

Please download to get full document.

View again

of 9
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Information
Category:

Entertainment & Humor

Publish on:

Views: 20 | Pages: 9

Extension: PDF | Download: 0

Share
Transcript
Theses Biologically active salivary proteins, functional studies of the alpha-amylase and the epidermal growth factor Dr. Ákos Nagy Dental Research, Clinical Medicine Semmelweis University, School of Ph.D. Studies INTRODUCTION Saliva and its constituents carry out a number of biological functions that are key to maintaining oral health. The component proteins produced and released into saliva by the salivary glands are grouped according to their functions: lubrication of the oral cavity (mucins, prolinerich proteins), remineralization (statherin, proline-rich proteins), digestion (amylase, lipase, proteases), antimicrobial activity (lysozyme, peroxidases, histatins), and mucosal integrity (water, mucins, growth factors). The saliva and its constituents are important diagnostic factors. Certain diseases as diabetes and Sjögren s syndrome or drug and x-ray therapy can change the quality and quantity of saliva. Although it is well known that several salivary proteins play an important role in the systematic processes little information is available regarding the mechanism by which these proteins reach the circulatory system. In cases of decreased secretion, it is a possibile to supplement these proteins and recover normal oral health. AIM Our experiments were carried out to investigate two salivary proteins, a-amylase and epidermal growth factor. 1. Serum amylase level is an important diagnostic factor in certain salivary and pancreatic diseases. Digestive enzymes in serum are common symptoms for acute pancreatitis and mumps, but digestive enzymes are normal constituents of blood, under physiological conditions, as well. The study was carried out to investigate the relationship between parotid isoamylase concentrations in blood serum and in parotid tissue in response to various stimuli. 2. Both patients with type 1 and type 2 diabetes, as well as animal models of diabetes, have reduced levels of EGF in their saliva. In our investigation, we examined the impact of diabetes on wound healing by measuring the rate of oral wound healing after tonguepunch biopsies. With the onset of type 1 diabetes, NOD mice exhibit a decrease in the concentration of EGF in saliva with a concomitant decrease in oral wound healing rate that could be reversed with the addition of EGF to the drinking water. MATERIALS AND METHODS Experimental protocol 1 Female Wistar rats were housed under standard conditions (24ºC, light cycle) and received standard rat chow and water ad libitum. In the first experiments, after 16 hours, fasting rats received either 5mg/kg pilocarpine-hcl or saline. After 1 hour, blood and parotid glands were collected. In the second experiments, after 16 h fasting, half of the rats were fed for 1 hour, the other half received no food. After 1 h, blood and parotid glands were collected. In the third experiments rats were allocated into two groups. All of the animals were fed ad libitum up to the start of the experiment. Then in the first group just before the light was turned off, food was withdrawn, and animals were sacrificed 2 h later. Food was not withdrawn in the other group, and rats were also sacrificed after 2 hours. Evaluation of amylase activity After collection blood was centrifuged at 2500g at 4ºC and the serum was stored at -20ºC until assayed. Electrophoresis of serum samples was performed in 0.9% agarose gels at ph 8.6 in Veronal buffer at 80V. Parotid and pancrteatic amylase isoforms were separated utilizing their opposite charges at ph 8.6. Amylase activity was determined from the isoenzyme bands of the gel. For tissue analysis parotid glands were weighed and homogenized in Tris-buffer ph 7.4. The homogenates were centrifuged at 2500g at 4ºC for 10 minutes. The supernatant was used for evaluation of amylase activity. Amylase activity was determined by iodine-starch color reaction. The substrate solution consisted of starch (4g/L), Tris-HCl (60mM), NaCl (50mM), CaCl 2 (0.001mM) at ph 7.4. The iodine solution included I 2 (0.2mM), KI (3mM), HCl (30mM). Samples were given to substrate solution for 5-10 min at 37 ºC. The reaction was stopped by pipetting equal volume of the incubation mixture into the iodine solution with simultaneous stirring. The OD was red at 620nm. Dilution series of starch solution served as internal calibration points. Under this condition there was a linear correlation between the change of optical density and the amount of the digested starch. The value of activity was given as unit (U) that equals 1g starch digested in 1 min. Values were given as mean±s.e.m. The percentage of inhibition was calculated as percentage of control. Comparison among the groups was performed by analysis of variance (ANOVA). Experimental protocol 2 Female NOD/LtJ and BALB/cJ mice between 7 and 10 weeks of age were used. Onset of diabetes in NOD/LtJ mice was determined by measuring urine and blood glucose levels. Mice with blood glucose levels 280 mg/dl for 2 consecutive weeks were considered diabetic. Mice become overtly diabetic starting at 12 ± 2 weeks of age. For the current experiments, mice weeks of age were used to minimize xerostomic conditions related to the development of Sjögren s syndrome like exocrine tissue pathology, which does not develop before weeks of age. Diabetic mice were maintained on daily intramuscular insulin for 2 weeks before the initiation of the wound-healing experiments. Treatment and wounding of the tongue in mice Healthy, age-matched BALB/cJ mice, prediabetic NOD/LtJ mice, and insulin-maintained diabetic NOD/LtJ mice were divided randomly into three groups (n = 4 6 mice) and sedated with an i.p. injection of 0.3 ml of pentobarbital (1% in phosphate-buffered saline). Superficial circular punch biopsy wounds measuring ~2.0 mm were made in the middle of the tongue using a 1.0-mm Biopsy Punch by ablating the epithelial layer without damage to the underlying muscle. During sedation, three photographs of the wound areas were taken for each animal. For 4 days thereafter, animals were anesthetized every 24 h and new photographic documentation of the wound site healing was recorded. Animals that received EGF were provided 20 ml of fresh drinking water that contained 2.5 µg of EGF/ml, or regular tap water. Wounds healed typically within 4 days. After examinationof wound healing on day 4, animals were killed, and the submandibular gland, tongue, and total body weight were obtained. Measurement of wound area While the animals were anesthetized, the maximum length and width of the wounds were measured using a stereomicroscope equipped with a calibrated eyepiece. The wound size was confirmed by the photographic data before calculation of the wound area. Wound margins were identified easily, and wound size was calculated using the formula A=LWp/4. RNA isolation and RT-PCR detection of EGF mrna After the animals were killed, the submandibular glands were explanted, minced in phosphate-buffered saline, and placed in lysis buffer, and mrna was isolated using a Micro- FastTrack Kit (Invitrogen). Isolated mrna was stored at -70 C in ethanol until all samples were collected. After isolation, mrna was pelleted by centrifugation, and cdna was prepared by reverse transcription using Superscript II Reverse Transcriptase. Copy DNA was synthesized in a standard 20µl reverse transcriptase reaction and subsequent amplification of the desired mrna byprimer addition using the Perkin-Elmer-Cetus reverse transcriptase polymerase chain reaction (RT-PCR) kit with the additionof 1.0µg of mrna. The amplification conditions were 94 C for 1 min, 58 C for 1 min, and 72 C for 3 min in a Biometra thermocycler for 25 cycles. The primer sets used were as follows: ß-actin, forward 5'TGAAGGTCGGTGTGAAAACGGATTTGGC3', reverse 5'CATGTAGGCCATGAGGTCCACCAC3'; and EGF, forward 5'TAAGCCGAGACCGGAAGTACT3', reverse 5'AGTCTGTTCCATCAAATGCA3'. Densitometric analyses were performed to determine changes in the steady-state levels of mrna for EGF relative to the concentrationdetected for the housekeeping gene ß-actin. All measures of variance are given as standard errors of the mean. The distribution of rates for wound healing was found to be normal (P 0.05) and was analyzed by a parametric analysis of variance (ANOVA). RESULTS Results 1 Serum amylase level in nonfasted rats was 5.78±0.79U/L. In rats fasted for 16 h we found a decreased level 4.1±068U/L. We observed, that under our experimental conditions parotid tissue amylase activity in nonfasted animals was 5.0±0.94U/100mg. Following 16 h food withdrawal this value was found to be 7.69±1.52U/100mg. We also observed that the electroforetic mobilities of parotid amylase and serum parotid isoamylase were very similar, while the pancreatic isoamylase in serum samples moved to the opposite direction. In the first experiment we studied the effect of pilocarpine on changes of serum and parotid tissue levels of the isoenzyme. We found a 39±9% (P 0.01) decrease in tissue activity, and a 101±39% (P 0.01) increase in in serum activity after one hour of pilocarpine administration. In the next experiment, in fasted animals the effect of re-feeding was investigated. In rats fasted for 16 h, 1 h feeding resulted in a 35±15% (P 0.01) decrease in tissue activity, and a 41±17% (P 0.05) increase in serum activity. Finally, the effect of food intake on parotid and serum amylase was studied in nonfasted animals during the first 2 h of the dark period. Rats consume a large amount of food following the light period during this phase. Under these conditions, after the first 2 h of the spontaneous food intake, tissue amylase level decreased by 27±7% (P 0.01). In parallel, serum amylase level increased by 16±1% (P 0.05) compared to values obtained in animals from which food was withdrawn just before the light was turned off. Results 2 With the onset of diabetes in NOD/LtJ mice, there was a concomitant decline in the concentration of salivary EGF. Consistent with this observation, RT-PCR analysis of mrna from the submandibular gland of healthy control female BALB/c mice and prediabetic and diabetic NOD/LtJ mice revealed a reduction in the steady-state concentration of EGF mrna with diabetes onset. Based on densitometric analysis of the amplicons in agarose gels, diabetic NOD/LtJ mice had a 25 30% (P 0.05) reductionin EGF mrna, as compared with control mice. Prediabetic NOD/LtJ mice, when compared with BALB/cJ mice, showed a reduction of 5%. Prediabetic NOD/LtJ mice, however, reportedly have a substantially higher concentration of EGF protein in their saliva than female BALB/cJ mice (34 vs. 54ng EGF/ml). With the use of a punchbiopsy apparatus, BALB/cJ, prediabetic NOD/LtJ, and diabetic NOD/LtJ mice received a lingual surface wound. The rates of healing of these wounds then were followed over a 4-day period. Prediabetic NOD/LtJ mice healed within 3 days of wounding, whereas both BALB/cJ and diabetic NOD/LtJ mice still had measurable wound sites (P 0.01). Although the same procedures and apparatus were used for the wounding of mice within each group, the initial wound size in diabetic NOD/LtJ mice was 67% of the nondiabetic mice (21 mm 2 for prediabetic vs. 14 mm 2 for diabetic NOD/LtJ). With respect to normal wound-healing rates, prediabetic NOD/LtJ mice had a 100% reduction in the wound area (P 0.001) over the 4-day observation time. BALB/cJ mice had an83% reduction in wound area, whereas diabetic NOD/LtJ mice had wound sites that were reduced in size only by 58% (P 0.05), even accounting for the smaller initial wound size. Taking this into account, the order of healing rates among the groups of mice were prediabetic NOD/LtJ BALB/c J diabetic NOD/LtJ. Introduction of EGF into the drinking water of BALB/cJ and prediabetic NOD/LtJ mice yielded a slightly more rapid wound-healing process when compared with syngeneic mice that were not provided exogenous EGF (P 0.05). This was true for each of the 3 days on which measurements of the wound area were taken. Similarly, diabetic NOD/LtJ mice that received exogenous EGF also showed markedly increased rates of healing, nearly approaching those of the prediabetic NOD/LtJ and BALB/cJ mice. At each of the three 24-h time measurements, the wound areasdecreased by 25, 38, and 77%, respectively (P 0.01). Despite the smaller wound size of the diabetic NOD mice at the time of the punch, the size of the wound areas at h were in general healing more rapidly than those of the mice that had not received EGF in the drinking water (P 0.05). DISCUSSION We found that pilocarpine administration-induced tissue amylase discharge was accompanied by a considerable increase in serum parotid isoamylase level. We observed a similar decline in parotid tissue and rise in serum levels of the enzyme when fasted animals were refed. Finally, in non-fasted, ad libitum fed rats, food intake in the early dark period also induced a decrease in parotid tissue amylase and an increase in serum isoamylase levels. Our observation that the electrophoretic mobilities of parotid amylase and serum parotid isoamylase are very similar, while the pancreatic amylase in serum samples moves to the opposite direction during electrophoresis, confirms the data from earlier investigators. Those studies showed that parotid isoamylase is the primary component of circulating amylase, although at a lower degree amylases originating from the pancreas and the liver also contribute to the sum of serum enzyme activity. Our findings regarding the effect of pilocarpine on serum and parotid amylase levels are also in line with previous reports. However, our study is the first, to show that both parotid and serum amylase is controlled by spontaneous food intake in rats. Our study was the first to specifically examine the impact of diabetes on the salivary- EGF wound-healing model. We provided evidence that naturally occurring autoimmune type 1 diabetes also has a reduced expression of EGF levels. Messenger RNA analysis of the submandibular gland confirmed previous protein analyses that showed a reduction in saliva and serum concentrations of growth factors in diabetic animal models. The reduced levels of growth factors in saliva seem to decrease the wound-healing capacity of oral epithelium. However, consistent with previous reports, addition of EGF to the drinking water of normal healthy mice or prediabetic NOD/LtJ mice did not accelerate wound healing. Only in the diabetic mice, with reduced concentrations of salivary EGF, did supplementation with EGF improve the kinetics of healing to a similar level as that detected in the healthy controls. CONCLUSION The antiparallel changes in the parotid and serum parotid isoamylase levels can be attributed to food-stimulated activation of neuronal and hormonal pathways leading to the discharge of parotid amylase into saliva and also to the elevation of the enzyme activity in the serum. In conclusion, we provided further evidence that saliva-derived EGF is an important protagonist in oral wound healing. Furthermore, metabolic disorders, such as diabetes, reduce the level of EGF in saliva with the consequence that the normal wound-repair process is negatively affected. The introduction of growth factor supplementation may be beneficial to patients with identified complications in situations that require tissue repair associated with dysregulation of salivary sources of EGF. AKNOWLEDGMENTS Thanks to Professor Tivadar Zelles, my tutor for showing me the beauty of scientific work and for driving me to be a scientist. So many times Professor Gábor Varga with his penchant for discipline helped me to advance. He and papers. Dr. Michael Humphreys-Beher also gave me a special hand with writing the Thanks to my wife for helping me to do all this work. The theses are based on the following publications 1. Nagy A, Nagashima H, Cha S, Oxford GE, Zelles T, Peck AB, Humphreys-Beher MG, Reduced oral wound healing in the NOD mouse model for type 1 autoimmune diabetes and its reversal by epidermal growth factor supplementation, Diabetes 50(9): , 2001 IF: 7, Nagy A, Barta A, Varga G, Zelles T,Changes of salivary amylase in serum and parotid gland during pharmacological and physiological stimulation, J Physiol Paris 95(1-6): , 2001 IF:1,339
Related Search
Similar documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks